This answer and BLT above seem to be the two poles of the kink. Autism spectrum rope and knot loving attention to detail and “shut the fuck up I’m tying you up.” I think both are pretty great.

Same. Everything goes into the pot and it all gets spent on the kids stuff.

Fine, we’ll use Force lightning again.

It’s kind of like the way a cat “escapes” a cardboard box. If they wanted them to not break out of the sandbox they could make it so they wouldn’t break out of the sandbox. That wouldn’t be very cash money though.

ttttgcaaaattagccgcgcggaactg

Speak for yourself, a shirt that says FUCK TiRbUMgPt is hilarious

How else am I supposed to remember that we need more?

The Gallipoli of the culture war

Here’s a paper with lots of evidence cited. There’s lots and lots and lots and lots more. Note that when these authors say “traditional” courses of treatment they mean the length of treatment that every single doctor in the Western world will prescribe. That it’s vitally important that you take all of. But it’s longer than it needs to be. Why not take them for six weeks “just in case?” Ultimately, the more we use antibiotics the less time we will have where they are useful. It’s better to use them as sparingly as possible within safe margins if we want to be able to keep using them.

I appreciate the positivity in your response by the way. I really struggle with not coming off as a huge asshole online and that’s an excellent way to soften a point that you don’t mean to be harsh. I’m going to try and start using it.

You have nothing to criticize yourself over here.

but unironically. Your symptoms come from your immune response, not the bacteria. When the molecular machinery that can detect femtomolar levels of bacterial antigen turns off it’s a solid sign that it’s been kicked.

I’m doing my best to try not to be combative, I am well-versed in immunology. I obviously wasn’t accusing you personally of seeking out antibiotics in the same way I wasn’t calling for you personally to go out and jail anybody.

The body of medical literature disagrees with what you are saying. There was a time where doctors would deride you if you tried to explain disease as something other than an imbalance of the humors. There was a time beyond that when laypeople would do the same. Eventually evidence won but medicine moves slowly. The evidence does not support the notion that longer courses of antibiotics are necessary, beneficial, or even harmless.

No worries at all and you’re 100% in the right place. I’ve had this same interaction with multiple MDs that I know so it’s not like this is widespread information. I just have the right mixture of ASD and science training that collects weird information and doesn’t let it go.

I can’t post the entire body of evidence from the intervening 13 years since that paper was published but it agrees with what I’m saying because my opinions are based on that body of evidence.

Big assumptions on the competent immune system

A deliberate assumption. You need one of those to clear an infection, if you’ve got a compromised immune system and a doctor tells you to fuck off and take some pills for a bacterial infection they’re committing malpractice.

If you stop taking the antibiotics and the strep comes back

That’s just not what is seen clinically. People stop their antibiotics early all the time, it’s practically baked into the treatment protocols. If that were the primary or even a major mechanism of drug resistance people would be dropping dead left right and center from common infections.

The other thing is that I’m not advocating for “just do whatever you want with antibiotics,” that’s the opposite of what I’m saying. Every time you take antibiotics you are exposing hundreds of millions of distinct microbial populations to that drug, not just the single pathogenic organism. People should be much more aware of when it is necessary to use antibiotics and when it is unnecessary and understand that unnecessary use is potentially harmful.

Ultimately, take your full course or stop a couple of days early if you’re already better, it makes little difference, just don’t go out begging for antibiotics every time you’ve got a runny nose. Also jail agricultural executives.

Giving a cat a pathetic human name is an insult to cat supremacy. They should be named things like ‘Garbage’ or ‘Stinky.’

I’m really sorry for your horrible experience and I hope you can stumble into proper care sooner rather than later. My regular NP left my covered psych office a couple of years ago and I had crippling anxiety until I got to meet the new one because they can just decide to cut you off from incredibly helpful medication on a whim.

Here’s a random paper from 2013 talking about it. It’s something that is a little tough to nail down but the evidence since then consistently points to antibiotic resistance genes arising in native flora rather than the pathogens themselves and then getting opportunistically picked up by pathogens later.

It makes intuitive sense if you know how horizontal gene transfer works in bacteria (which most people don’t because it’s complicated and weird), but imagine exposing a single strep infection to a single course of antibiotics. Even if you don’t kill every cell with the drug, you’ve almost certainly weakened it enough for a competent immune system to finish mopping the floor with the infection. Now imagine the trillions of other bacteria that are always present in your body being exposed to every course of antibiotics that you’ve ever taken and, rather than being cleared by the immune system, repopulating. Which of those scenarios is more likely to encourage resistance? Now add in the fact that most bacteria can drink each other’s milkshakes and you’ve got an inevitable MDR crisis brewing.

But also agriculture. My God is agriculture bad for developing drug resistance genes.

That essentially used to be the case at the dawn of antibiotics when someone was septic and they took some penicillin and went from (accurately) feeling like they were about to die to feeling dramatically better but still needing to continue the course to adequately clear the infection from the bloodstream. Now if you’re septic you’ll get pumped full of IV Augmentin in a hospital and ramp it up from there if it’s not clearing, you don’t get the option of deciding to stop early.

Modern medical evidence points to the importance of always finishing your antibiotic course to be a myth that leads to unnecessary extended antibiotic exposure.

I’m not dangerously wrong, I’m dangerously up to date on medical literature. There’s been a lot of debate about the subject but it came to a head about ten years ago and most modern evidence points to the advice being mainly a relic of early antibiotic studies and anecdotes.

There are certain treatment courses that are long for a reason and certain courses that are long because “it can’t hurt to make sure” and almost no one is knowledgeable about which is which and why. Medicine is stubborn and takes multiple generations to shift practices from something that “has always worked” to something new that is supported by evidence.

It’s a pretty good indication actually. Your body is extremely well-tuned to pick up on the presence of bacterial infection.